Актинидия дальневосточная полезные свойства


Ягоды актинидии польза и вред

Актинидия полезные свойства и противопоказания

Сегодняшняя статья о растении актинидия, полезных свойствах ягод актинидии, их пользе для организма человека. Растение, родина которого Китай было известно несколько тысячелетий назад. Ее привез садовник любитель, которому понравился необычный кустарник. Около 30 лет потребовалось ему, его помощникам, чтобы вырастить замечательную лиану с опушенными ягодами, по вкусу напоминающими смесь банана, земляники, дыни и ананаса. Первое время она была популярна в Сибири, где ее называли «сибирским киви» и лишь потом распространилась по всей стране.

Вьющееся растение актинидия встречается в лесах Дальнего Востока, В Юго-Восточной Азии. Прорастая вокруг различных опор, высоких деревьев лиана образует пышную, зеленую крону из молодых побегов. На ровных, открытых местах кусты актинидии образуют непроходимые заросли.

Плоды актинидии — округлая, немного удлиненная ягода с нежной, ароматной мякотью. Всего лишь с одного растения собирают около 22кг ароматных ягод актинидии. Выведено примерно около 30 видов растения, наиболее распространены:

Актинидия коломикта или амурский крыжовник как ее называют. Ягоды данного сорта актинидии зеленые, размером около 4см. Мякоть душистая, сладкая по вкусу сильно напоминает ягоды крыжовника.

Актинидия китайская или киви — популярный фрукт, который прочно обосновался на нашем столе.

Актинидия аргута или острая актинидия имеет большие, сладкие плоды, напоминающие вкус ананаса.

Актинидия полигамная — чаще выращивается как для украшения садов. Из-за необычного вкуса, резко-жгучего вкуса считается несъедобной.

 Состав актинидии

  • просто огромное количество аскорбиновой кислоты, одного куста актинидии достаточно, чтобы обеспечить аскорбиновой кислотой семью из трех человек на год.
  • есть сахара, органические кислоты
  • пектины, дубильные вещества
  • природная вода, крахмал
  • клетчатка
  • дубильные вещества
  • гликозиды сердечные
  • витамины А, Р
  • эфирные масла

 Актинидия для здоровья

  • укрепляет организм
  • имеет послабляющее действие
  • успокаивает подобно валерианке
  • сырые ягоды актинидии утоляют жажду, это диетический продукт, который полезен для взрослых и детей
  • помогает при заболевании органов пищеварения, приводящих к запорам
  • ягоды актинидии полезны при расстройствах желудка, связанных с нервозностью
  • рекомендуют при болезнях легких, анемии
  • актинидия лечит туберкулез, заболевание коклюш, бронхит
  • рекомендуют при кариесе
  • избавляет от глистов
  • останавливает кровь
  • снимает боль
  • полезна при часто возникающих головокружениях, головных болях
  • при приступах стенокардии, ревматизме выручит настой листьев, цветков
  • отвар из сухих ягод актинидии полезен при нарушениях кровообращения мозга
  • кора экзотического растения понижает боль, останавливает кровь, имеет общеукрепляющие свойства
  • полезна при воспалении полости рта
  • концентрированный настой плодов — профилактическое средство от рака
  • сок актинидии — помогает бороться с авитаминозом, улучшает аппетит, хорошо заживляет раны, лечит мокрую экзему
  • ягоды полезны для работы сердца, помогают от несварения желудка
  • избавляют от частой отрыжки, изжоги
  • используют для спринцевания, тампонов при лечении женских заболеваний
  • повышает тонус, упругость кожи

Актинидия в кулинарии

Кулинарные рецепты с актинидией разнообразны. Ягоды актинидии отлично подходят для пирогов, вкусного варенья, повидла, служат основой для приготовления вина или маринада. В странах Востока идут в пищу молодые побеги, листочки некоторых видов актинидии.

Варенье из актинидии

Чтобы сохранить все полезные свойства ягод актинидии растирают плоды с сахаром. На килограмм ягод потребуется 1,2кг сахара. Без варки варенье храниться в холодильнике около года. Если варить берут поровну ягоды и сахар, смешивают. Как только раствориться сахар варят четверть часа. Такое варенье можно хранить более года.

Компот из актинидии

Спелые ягоды актинидии без повреждений помещают в банки. Заливают сиропом из 300г сахара и литра воды. Прогревают банки 1/2л 10 минут при 80 градусах.

Актинидия для лица

Питательная маска

Растирают мякоть трех плодов, добавляют половинку банана и 2ст.л. йогурта. Время — четверть часа. Хорошо действует на кожу особенно в холодное время.

Маска для увядающей кожи

Разрезают плод, протирают лицо кусочком фрукта, оставляют на 1/4часа. Особенно полезна людям, которые много бывают на воздухе.

Очищение лица

Наносят мякоть на лицо, делают легкий массаж кончиками пальцев. У этого натурального скраба нет противопоказаний, можно применять несколько раз за неделю, чтобы очистить поры, удалить омертвевшие клетки.

Лечение актинидией

Настой плодов

Полезные ягоды актинидии — 2ст.л., кипяток — литр. Состав оставляют в термосе на ночь. Пьют первый стакан утром перед едой, два других в обед, вечером. Лечатся 4 недели. Витаминный напиток принимают, чтобы укрепить иммунитет, избавиться от вздутия, запоров.

Настой листьев, цветков

Цветки листья актинидии — 20г, кипяток — 20мл прогревают на водяной бане 1/4часа и охлаждают. Употребляют трижды за день для лечения суставов, подагры, радикулита, стенокардии.

Настой корней

Очень мелко порезанные корешки актинидии заливают кипящей водой, оставляют на водяной бане до получения концентрированного настоя. Используют для полоскания рта при стоматите, женских воспалительных заболеваниях, суставных болях.

Концентрированный настой плодов от рака

Ягоды актинидии заливают кипящей водой, оставляют на водяной бане пока не получится концентрированный настой. Употребляют небольшими дозами сразу после еды. Редкий витамин в составе подавляет рост клеток рака

Отвар коры

Кора актинидии — 20г, кипяток — стакан выдерживают на водяной бане пол часа и охлаждают. Пьют после еды 2ст.л.

Мазь из актинидии

1. подойдут плоды горьких сортов. Их тщательно растирают с масляной основой. Используют как наружное средство для массажа после травм, переломов.

2. берут поровну плоды и жир свиной. Растирают постепенно добавляя порошок горчицы. На 50г требуется 1ст.л. порошка. Смазывают проблемное место дважды за сутки.

Стенокардия

Листья актинидии — 7 штук, вода — стакан. Состав ставят на слабый огонь, выдерживают четверть часа и охлаждают. Пьют трижды за день месяц. После двух недельного перерыва лечение повторяют.

Мокнущая экзема

Смазывают проблемные места соком плодов актинидии трижды за сутки.

Актинидия противопоказания

  • может спровоцировать сильную аллергию. Первый прием проводят с осторожностью, особенно при беременности
  • тромбофлебит
  • варикозное расширение вен
  • высокая свертываемость крови
  • при переедании возможно расстройство пищеварения
  • сок актинидии не стоит употреблять при заболевании почек, гастрите с высокой кислотностью или язвой желудка

Actinidia arguta - Полезные растения умеренного климата

(Siebold & Zucc.) Planch. ex Miq.

Actinidiaceae


Этот вид имеет широкий ареал: он встречается на востоке России, в Корее и Японии, а также на большей части территории Китая. Как и многие другие виды актинидий, широко распространенные географически, он полиморфен. Варианты, как правило, имеют разные географические регионы, и некоторые из них были разделены на отдельные разновидности или даже отдельные виды.Одной из самых характерных является Actinidia arguta purpurea (син. Actinidia purpurea Rehder), которая преобладает на юго-западе Китая. Плоды у нее длинные и темно-фиолетовые [1056
Title
Генетические ресурсы киви: приручение и разведение
Публикация
Обзоры садоводства; Vol. 33
Автор
А. Росс Фергюсон; Hongwen Huang
Издатель
John Wiley & Sons, Inc.
Год
2007
ISBN
978-0-471-73214-3
Описание
Очень подробный взгляд на садоводческие перспективы киви (вид актинидии).
].
Классификация рода Actinidia затруднительна, а систематизация некоторых таксонов все еще вызывает затруднения. Различные исследования, проведенные с 1984 года, оценили, что этот род включает от 54 до 76 видов. Виды актинидий сильно различаются по своей вегетативной структуре, а также по цветам и плодам, что является основной причиной трудностей при классификации рода. Для прояснения ситуации необходимо подробное изучение рода, основанное на широком диапазоне образцов, и может потребоваться еще много лет работы, пока не будет найдена естественная классификационная система - Xinwei LI, Jianqiang LI, Djaja Djendoel SOEJART; Успехи в изучении систематики актинидии Линдли; Фронт.Биол. China 2009, 4 (1): pp 55 - 61.
Применяемое здесь лечение основано в основном на Флоре Китая [266
Название
Флора Китая
]
Публикация
Автор
Веб-сайт
http://flora.huh.harvard.edu/china/
Publisher
Missouri Botanical Garden Press; Святой Луи.
Год
1994
ISBN
Описание
Отличный исчерпывающий ресурс в 25 томах.Помимо ботанической информации, флора также дает основную информацию о среде обитания и некоторых видах использования. Также доступна онлайн-версия.
] с некоторыми более поздними поправками [K
Title
Plants for a Future
Автор
Кен Ферн
Описание
Заметки о наблюдениях, дегустациях и т. Д. На заводах «Растения будущего» и во время экскурсий.
].

Actinidia callosa arguta (Siebold & Zucc.) Макино

Actinidia chartacea Hu

Actinidia giraldii Diels

Actinidia hypoleuca Накай

Актинидия японская Накаи

Actinidia megalocarpa Накаи и Китаг.

Actinidia melanandra latifolia E.Pritz.

Actinidia platyphylla A.Серый экс Miq.

Actinidia purpurea Rehder

Actinidia rufa arguta (Siebold & Zucc.) Dunn

Actinidia rufa typica Данн

Общее название: Тара Вайн
Развивающиеся плоды сорта 'Ананасная', растущего в Ботаническом саду UBC, Ванкувер
Фотография: Венди Катлер

Общая информация

Actinidia arguta - листопадный вьющийся кустарник с одним или несколькими длинными ветвистыми стеблями, которые поддерживают себя, обвивая ветви и т. Д. Близлежащих растений [200
Название
Новый словарь садоводства RHS.1992.
Публикация
Автор
Хаксли. А.
Издатель
MacMillan Press
Год
1992
ISBN
0-333-47494-5
Описание
Отлично и очень исчерпывающе, хотя и содержит ряд глупых ошибок. Читабельно, но также очень подробно.
].
Растение собирают в дикой природе для местного использования в пищу. Его все чаще выращивают из-за съедобных плодов, которыми часто торгуют.Было разработано несколько названных форм.

Известные опасности

Неизвестные

Справочные материалы по ботанике

11
Название
Деревья и кустарники, выносливые в Великобритании. Том 1-4 и Дополнение.
Публикация
Автор
Бин. W.
Издатель
Мюррей
Год
1981
ISBN
Описание
Классика с большим количеством информации о растениях, но скудной картинкой.
, 200
Название
Новый словарь RHS по садоводству. 1992.
Публикация
Автор
Хаксли. А.
Издатель
MacMillan Press
Год
1992
ISBN
0-333-47494-5
Описание
Отлично и очень исчерпывающе, хотя и содержит ряд глупых ошибок. Читабельно, но также очень подробно.
, 266
Название
Флора Китая
Публикация
Автор
Сайт
http: // флора.huh.harvard.edu/china/
Publisher
Missouri Botanical Garden Press; Святой Луи.
Год
1994
ISBN
Описание
Отличный исчерпывающий ресурс в 25 томах. Помимо ботанической информации, флора также дает основную информацию о среде обитания и некоторых видах использования. Также доступна онлайн-версия.

Диапазон

E. Азия - Дальний Восток России (Приморье, Сахалин), Китай, Япония, Корея

Среда обитания

Лазание по деревьям в лесных массивах, горных лесах, зарослях, берегах рек и влажных местах на высотах от 700 до 3600 метров [ 11
Название
Выносливые деревья и кустарники в Великобритании.Том 1-4 и Дополнение.
Публикация
Автор
Бин. W.
Издатель
Мюррей
Год
1981
ISBN
Описание
Классика с большим количеством информации о растениях, но скудной картинкой.
, 198
Заголовок
Журнал дендрария Арнольда. Vol. 33.
Публикация
Автор
Li.H. L.
Веб-сайт
http://www.biodiversitylibrary.org
Издатель
Гарвардский университет
Год
1952
ISBN
Описание
Ботанический журнал, он содержит монографию по роду Актинидия. Доступно для загрузки из Интернета.
, 266
Название
Флора Китая
Публикация
Автор
Сайт
http: // флора.huh.harvard.edu/china/
Publisher
Missouri Botanical Garden Press; Святой Луи.
Год
1994
ISBN
Описание
Отличный исчерпывающий ресурс в 25 томах. Помимо ботанической информации, флора также дает основную информацию о среде обитания и некоторых видах использования. Также доступна онлайн-версия.
].

Недвижимость

Рейтинг съедобности
Привычка Лиственный альпинист
Высота 15.00 м
опылители Пчелы, насекомые
Самостоятельное оплодотворение Нет
Статус выращивания Культивируемый, дикий

Подробные сведения о выращивании

Очень выносливое растение, переносящее температуры до -30 ° C и ниже, хотя молодые весенние отростки чувствительны к морозам [160
Title
Wonder Crops. 1987.
Публикация
Автор
Natural Food Institute,
Издатель
Год
ISBN
Описание
Увлекательное чтение, это ежегодное издание.Однако некоторые сообщения кажутся несколько преувеличенными.
]. Говорят, что некоторые сорта в состоянии полного покоя выдерживают температуры до -50 ° C [160
Title
Wonder Crops. 1987.
Публикация
Автор
Natural Food Institute,
Издатель
Год
ISBN
Описание
Увлекательное чтение, это ежегодное издание.Однако некоторые сообщения кажутся несколько преувеличенными.
]. Растение цветет и плодоносит в более теплых частях умеренной зоны и все чаще рассматривается как имеющее потенциал даже в более прохладных районах [183
Title
Рог изобилия - Справочник съедобных растений.
Публикация
Автор
Facciola. С.
Издатель
Публикации Кампонг
Год
1990
ISBN
0-9628087-0-9
Описание
Отлично.Содержит очень широкий спектр традиционных и нетрадиционных пищевых растений (включая тропические) и места их получения (в основном питомники Северной Америки, но также научно-исследовательские институты и множество других питомников со всего мира.
].
Предпочитает крепкую суглинистую нейтральную почву [1
Title
RHS Dictionary of Plants plus Supplement. 1956
Публикация
Автор
Ф. Читтендон.
Издатель
Oxford University Press
Год
1951
ISBN
Описание
Исчерпывающий список видов и способов их выращивания.Несколько устаревший, он был заменен в 1992 г. новым словарем (см. [200]).
, 200
Название
Новый словарь RHS по садоводству. 1992.
Публикация
Автор
Хаксли. А.
Издатель
MacMillan Press
Год
1992
ISBN
0-333-47494-5
Описание
Отлично и очень исчерпывающе, хотя и содержит ряд глупых ошибок.Читабельно, но также очень подробно.
]. Переносит кислые и умеренно щелочные почвы [202
Title
Альпинисты и кустарники.
Публикация
Автор
Дэвис. Б.
Издательство
Викинг.
Год
1990
ISBN
0-670-82929-3
Описание
Содержит информацию о 2 000 разновидностей и сортов с подробным описанием требований к выращиванию.Текст краткий, но информативный.
]. Хорошо работает в полутени, но для выращивания фруктов лучше всего подходит полное солнце [200
Title
Новый словарь RHS по садоводству. 1992.
Публикация
Автор
Хаксли. А.
Издатель
MacMillan Press
Год
1992
ISBN
0-333-47494-5
Описание
Отлично и очень исчерпывающе, хотя и содержит ряд глупых ошибок.Читабельно, но также очень подробно.
]. Предпочитает защищенное место [200
Название
Новый словарь садоводства RHS. 1992.
Публикация
Автор
Хаксли. А.
Издатель
MacMillan Press
Год
1992
ISBN
0-333-47494-5
Описание
Отлично и очень исчерпывающе, хотя и содержит ряд глупых ошибок. Читабельно, но также очень подробно.
].
Есть несколько названных разновидностей [183
Название
Рог изобилия - Справочник по съедобным растениям.
Публикация
Автор
Facciola. С.
Издатель
Публикации Кампонг
Год
1990
ISBN
0-9628087-0-9
Описание
Отлично. Содержит очень широкий спектр традиционных и нетрадиционных пищевых растений (в том числе тропических) и мест их получения (в основном N.Американские питомники, а также исследовательские институты и множество других питомников со всего мира.
].
Растения обычно двудомные, и в этом случае необходимо выращивать как мужские, так и женские формы, если требуются плоды и семена [200
Title
Новый словарь садоводства RHS. 1992.
Публикация
Автор
Хаксли. А.
Издатель
MacMillan Press
Год
1992
ISBN
0-333-47494-5
Описание
Отлично и очень исчерпывающе, хотя и содержит ряд глупых ошибок.Читабельно, но также очень подробно.
]. Однако некоторые формы, включая сорт 'Issai', являются самооплодотворяющими [200
Название
Новый словарь садоводства RHS. 1992.
Публикация
Автор
Хаксли. А.
Издатель
MacMillan Press
Год
1992
ISBN
0-333-47494-5
Описание
Отлично и очень исчерпывающе, хотя и содержит ряд глупых ошибок.Читабельно, но также очень подробно.
].
Женские растения дают морфологически совершенные цветки с хорошо развитыми пестиками и тычинками, но их тычинки производят нежизнеспособную пыльцу; цветки мужских растений имеют маленькие рудиментарные завязи без жизнеспособных семяпочек, но их тычинки выделяют жизнеспособную пыльцу [1056
Название
Генетические ресурсы киви: приручение и разведение
Публикация
Обзоры садоводства; Vol. 33
Автор
А.Росс Фергюсон; Hongwen Huang
Издатель
John Wiley & Sons, Inc.
Год
2007
ISBN
978-0-471-73214-3
Описание
Очень подробный взгляд на садоводческие перспективы киви (вид актинидии).
].
Полиморфный вид [74
Название
Флора СССР.
Публикация
Автор
Комаров. V. L.
Веб-сайт
http: // www.biodiversitylibrary.org
Издатель
Израильская программа научного перевода
Год
1968
ISBN
Описание
Огромный (25 и более больших томов) и еще не завершенный перевод русской флоры. Полный информации об использовании растений и средах обитания, но тяжелый для случайных читателей. Его можно скачать в Интернете.
].
Плоды образуются на древесине второго года жизни, а также на плодовых лозах на старой древесине [126
Заголовок
The Plantsman.Vol. 6. 1984 - 1985.
Публикация
Автор
?
Издатель
Королевское садоводческое общество
Год
1984
ISBN
Описание
Выдержки из периодического издания, дающие подробные сведения о выращивании и другие заметки о некоторых полезных растениях, включая виды актинидий и глициний.
], любую обрезку лучше проводить зимой [219
Title
Садоводство на стенах
Публикация
Автор
Грей-Уилсон.К. и Мэтьюз. V.
Издатель
Коллинз
Год
1983
ISBN
0-00-219220-0
Описание
Милая маленькая книжка о растениях для выращивания у стен и небольшой раздел о растениях, которые могут расти в стенах.
]. Растения цветут только в теплом климате [202
Title
Вьющиеся растения и кустарники.
Публикация
Автор
Дэвис.Б.
Издательство
Викинг.
Год
1990
ISBN
0-670-82929-3
Описание
Содержит информацию о 2 000 разновидностей и сортов с подробным описанием требований к выращиванию. Текст краткий, но информативный.
].
Растения этого рода особенно устойчивы к опоносу [200
Title
Новый словарь садоводства RHS. 1992.
Публикация
Автор
Хаксли.А.
Издатель
MacMillan Press
Год
1992
ISBN
0-333-47494-5
Описание
Отлично и очень исчерпывающе, хотя и содержит ряд глупых ошибок. Читабельно, но также очень подробно.
].

Съедобные виды использования

Фрукты - сырые, приготовленные или сушеные для последующего использования [1
Название
Словарь RHS по растениям плюс приложение. 1956
Публикация
Автор
F.Читтендон.
Издатель
Oxford University Press
Год
1951
ISBN
Описание
Исчерпывающий список видов и способов их выращивания. Несколько устаревший, он был заменен в 1992 г. новым словарем (см. [200]).
, 3
Название
Выращивание необычных фруктов.
Публикация
Автор
Симмонс. A. E.
Издатель
Дэвид и Чарльз; Ньютон Эббот.
Год
1972
ISBN
0-7153-5531-7
Описание
Очень удобная книга с информацией о примерно 100 видах, которые можно выращивать в Британии (некоторые в теплицах), и подробностями о том, как их выращивать и использовать.
, 61
Название
Словарь растений, используемых человеком.
Публикация
Автор
Usher. Г.
Издатель
Констебль
Год
1974
ISBN
0094579202
Описание
Забудьте о сексистских названиях, это одна из лучших книг по этой теме.Перечисляет очень широкий спектр полезных растений со всего мира с очень краткими подробностями использования. Не для случайного читателя.
, 105
Название
Циклопедия съедобных растений мира Танаки.
Публикация
Автор
Танака. Т. и Накао С.
Издательство
Издательство Кэйгаку; Токио
Год
1976
ISBN
Описание
Самый полный список съедобных растений, с которыми я встречался.Однако только самая краткая запись для каждого вида, а некоторые записи более чем сомнительны. Не для случайного читателя.
]. Лучшие формы имеют сладкий ароматный вкус [1056
Название
Генетические ресурсы киви: приручение и разведение
Публикация
Обзоры садоводства; Vol. 33
Автор
А. Росс Фергюсон; Hongwen Huang
Издатель
John Wiley & Sons, Inc.
Год
2007
ISBN
978-0-471-73214-3
Описание
Очень подробный взгляд на садоводческие перспективы киви (вид актинидии).
]. Слаще, чем киви (Actinidia deliciosa) [183
Название
Рог изобилия - Справочник по съедобным растениям.
Публикация
Автор
Facciola. С.
Издатель
Публикации Кампонг
Год
1990
ISBN
0-9628087-0-9
Описание
Отлично. Содержит очень широкий спектр традиционных и нетрадиционных пищевых растений (в том числе тропических) и мест их получения (в основном N.Американские питомники, а также исследовательские институты и множество других питомников со всего мира.
], кожица гладкая и мягкая, и ее можно есть вместе с фруктами [K
Title
Plants for a Future
Автор
Кен Ферн
Описание
Заметки о наблюдениях, дегустациях и т. Д. На заводах «Растения будущего» и во время экскурсий.
]. В плодах содержится до 5 раз больше витамина С, чем в черной смородине [74
Название
Флора СССР.
Публикация
Автор
Комаров. V. L.
Веб-сайт
http://www.biodiversitylibrary.org
Издатель
Израильская программа научного перевода
Год
1968
ISBN
Описание
Огромный (25 и более больших томов) и еще не завершенный перевод русской флоры. Полный информации об использовании растений и средах обитания, но тяжелый для случайных читателей.Его можно скачать в Интернете.
]. Высоко оценен согласно одному отчету [151
Title
Corean Flora.
Публикация
Автор
Уилсон. Э. Х. и Троллоп. М. Н.
Издатель
Королевское азиатское общество
Год
1918
ISBN
Описание
Очень маленький справочник, он дает немного информации о корейских заводах.
], в то время как другой говорит, что они безвкусные [11
Название
Деревья и кустарники Харди в Великобритании. Том 1-4 и Дополнение.
Публикация
Автор
Бин. W.
Издатель
Мюррей
Год
1981
ISBN
Описание
Классика с большим количеством информации о растениях, но скудной картинкой.
]. Плоды зеленовато-желтые или пурпурно-красные при созревании и около 2–3 см в длину [198
Title
Journal of the Arnold Arboretum.Vol. 33.
Публикация
Автор
Li. H. L.
Веб-сайт
http://www.biodiversitylibrary.org
Издатель
Гарвардский университет
Год
1952
ISBN
Описание
Ботанический журнал, он содержит монографию по роду Актинидия. Доступно для загрузки из Интернета.
, 266
Название
Флора Китая
Публикация
Автор
Сайт
http: // флора.huh.harvard.edu/china/
Publisher
Missouri Botanical Garden Press; Святой Луи.
Год
1994
ISBN
Описание
Отличный исчерпывающий ресурс в 25 томах. Помимо ботанической информации, флора также дает основную информацию о среде обитания и некоторых видах использования. Также доступна онлайн-версия.
]. Они содержат несколько мелких семян, но их легко съесть вместе с плодами [K
Title
Plants for a Future
Автор
Кен Ферн
Описание
Заметки о наблюдениях, дегустациях и т. Д. На заводах «Растения будущего» и во время экскурсий.
].

Растение богато соком, его можно собирать и пить весной. [

105
Title
Циклопедия съедобных растений мира Танаки.
Публикация
Автор
Танака. Т. и Накао С.
Издательство
Издательство Кэйгаку; Токио
Год
1976
ISBN
Описание
Самый полный список съедобных растений, с которыми я встречался.Однако только самая краткая запись для каждого вида, а некоторые записи более чем сомнительны. Не для случайного читателя.
, 177
Название
Растения для потребления человеком
Публикация
Автор
Кункель. Г.
Издательство
Научные книги Кельца
Год
1984
ISBN
3874292169
Описание
Отличная книга для посвященных.Полный список латинских имен с кратким списком съедобных частей.
, 183
Название
Рог изобилия - Справочник по съедобным растениям.
Публикация
Автор
Facciola. С.
Издатель
Публикации Кампонг
Год
1990
ISBN
0-9628087-0-9
Описание
Отлично. Содержит очень широкий спектр традиционных и нетрадиционных пищевых растений (в том числе тропических) и мест их получения (в основном N.Американские питомники, а также исследовательские институты и множество других питомников со всего мира.
].

Сушеные листья продаются на местных продовольственных рынках в Корее - в отчете не приводится подробная информация о том, как они используются [

1665
Название
Дикие кормовые растения в Южной Корее; Присутствие на рынке, новые культуры и экспорт в США
Публикация
Экономическая ботаника, Vol. 50, No. 1 (январь - март 1996 г.), стр. 57-70
Автор
Пембертон Р.W. & Нам Сук Ли
Веб-сайт
http://www.jstor.org/stable/4255805
Издатель
Год
1996
ISBN
Описание
].

Лекарственное средство

Не известно

Другое применение

Не известно

Размножение

Семена - посев весной в теплице [133
Название
Выращивание из семян. Том 1.
Публикация
Автор
Рис.Г. (редактор)
Издатель
Томпсон и Морган.
Год
1987
ISBN
Описание
Очень читаемый журнал с большим количеством информации о размножении.
]. Вероятно, лучше всего, если семена будут подвергнуты трехмесячной стратификации [113
Title
Справочное руководство по размножению древесных растений.
Публикация
Автор
Реж. М. А. и Хойзер.M. W.
Publisher
Athens Ga. Varsity Press
Год
1987
ISBN
0942375009
Описание
Очень подробная книга по размножению деревьев. Не для случайного читателя.
], либо сеять в холодном помещении, как только созреет поздней осенью, либо сразу после получения. Свежие семена прорастают через 2–3 месяца при 10 ° C, при хранении семена могут длиться дольше [133
Title
Выращивание из семян.Том 1.
Публикация
Автор
Рис. Г. (редактор)
Издатель
Томпсон и Морган.
Год
1987
ISBN
Описание
Очень читаемый журнал с большим количеством информации о размножении.
]. Когда они станут достаточно большими, чтобы их можно было обрабатывать, наколите саженцы в отдельные горшки и выращивайте их в светлой тени в теплице, по крайней мере, на первую зиму.Когда растения достигнут 30 см и более, высаживайте их на постоянное место в конце весны или в начале лета, после последних ожидаемых заморозков [K
Title
Plants for a Future
Автор
Кен Ферн
Описание
Заметки о наблюдениях, дегустациях и т. Д. На заводах «Растения будущего» и во время экскурсий.
]. Большинство саженцев - мужские [126
Название
The Plantsman. Vol. 6. 1984 - 1985.
Публикация
Автор
?
Издатель
Королевское садоводческое общество
Год
1984
ISBN
Описание
Выдержки из периодического издания, дающие подробные сведения о выращивании и другие заметки о некоторых полезных растениях, включая виды актинидий и глициний.
]. Саженцы подвержены увлажнению, поэтому их необходимо хорошо проветривать. [113
Title
Справочное руководство по размножению древесных растений.
Публикация
Автор
Реж. М. А. и Хойзер. M. W.
Publisher
Athens Ga. Varsity Press
Год
1987
ISBN
0942375009
Описание
Очень подробная книга по размножению деревьев.Не для случайного читателя.
].
Срезанные обрезки хвойных пород весной уже готовы в рамке [K
Title
Растения для будущего
Автор
Кен Ферн
Описание
Заметки о наблюдениях, дегустациях и т. Д. На заводах «Растения будущего» и во время экскурсий.
].
Черенки из недозрелой древесины, середина лета в рамке. Очень высокий процент [113
Название
Справочное руководство по размножению древесных растений.
Публикация
Автор
Реж. М. А. и Хойзер. M. W.
Publisher
Athens Ga. Varsity Press
Год
1987
ISBN
0942375009
Описание
Очень подробная книга по размножению деревьев. Не для случайного читателя.
].
Черенки спелой древесины, ранняя осень / поздняя осень в рамке.
.

Статья об актинидиях по The Free Dictionary

род растений семейства Actinidiaceae, вьющиеся кустарники (лианы), высоко поднимающиеся на деревьях, с листьями без прилистников. Растения актинидии раздельнополые, с однополыми (реже двуполыми) белыми, желтыми или красноватыми цветками и плодами в виде зеленых или зеленовато-желтых ягод. В восточной Азии существует около 35 видов. В СССР в лесах Дальнего Востока встречается пять видов. Съедобные ягоды, очень богатые аскорбиновой кислотой, используются в пищу (сырые, вареные или сушеные) или в качестве кондитерских изделий.

В СССР основным культивируемым видом является крыжовник амурский ( Actinidia kolomikta ); это очень выносливое растение, богатое витаминами (плоды содержат около 0,7% витамина С, 4,2–9,8% сахаров, 0,78–2,48% органических кислот и 0,73% пектина). Ягоды едят сырыми или в консервированном виде; они также используются в качестве профилактических и лечебных средств в домашних средствах от цинги, туберкулеза и других заболеваний. Актинидия болотная ( Actinidia arguta ) дает плоды с ароматом ананаса; его содержание витамина С составляет лишь часть от содержания Actinidia kolomikta.Актинидия аргута культивируется как декоративное растение. У серебряной лозы ( Actinidia polygama ) большие плоды, которые становятся съедобными после заморозков. Actinidia giraldii , вид, близкий к Actinidia arguta , имеет крупный плод до 4 см в диаметре; это никогда не культивируется. Actinidia sugawarana , как и Actinidia polygama , также не культивируется. Для выращивания в СССР представляет интерес актинидия китайская ( Actinidia chinensis ) - декоративное растение с крупными ароматными плодами длиной до 5 см.Культивируемые виды размножаются семенами и черенками на хорошо дренированной почве, богатой гумусом листьев. И. В. Мичурин вывел ценные новые сорта актинидии - актинидия ананасовая, Клара Цеткин, актинидия репчатая и другие.

СПИСОК ЛИТЕРАТУРЫ

Еникеев, Х. К. и И. Н. Шашкин, Восточноазиатские виды косточковых и актинидии . Москва, 1937.
Деревня и кустарники СССР , т. 4. Москва-Ленинград, 1958.

Большая Советская Энциклопедия, 3-е издание (1970-1979).© 2010 The Gale Group, Inc. Все права защищены.

.Актинидия

- wikiwand

Для более быстрой навигации этот iframe предварительно загружает страницу Wikiwand для Actinidia .

Подключено к:
{{:: readMoreArticle.title}}

Из Википедии, свободной энциклопедии

{{bottomLinkPreText}} {{bottomLinkText}} Эта страница основана на статье в Википедии, написанной участники (читать / редактировать).
Текст доступен под CC BY-SA 4.0 лицензия; могут применяться дополнительные условия.
Изображения, видео и аудио доступны по соответствующим лицензиям.
{{current.index + 1}} из {{items.length}}

Спасибо за жалобу на это видео!

Пожалуйста, помогите нам решить эту ошибку, написав нам по адресу support @ wikiwand.com
Сообщите нам, что вы сделали, что вызвало эту ошибку, какой браузер вы используете и установлены ли у вас какие-либо специальные расширения / надстройки.
Спасибо! .

Гепатопротекторная активность общих сапонинов из корня Actinidia valvata Dunn против повреждения печени, вызванного тетрахлоридом углерода у мышей

Защитная активность общих сапонинов из Actinidia valvata Dunn root (TSAV) изучалась против четыреххлористого углерода - (CCl - (CCl). 4 -) вызвало острое повреждение печени у мышей. Мышам перорально вводили TSAV (50, 100 и 200 мг / кг) в течение пяти дней, а затем вводили CCl 4 . Предварительная обработка TSAV значительно предотвратила вызванное CCl 4 повреждение печени, на что указывают маркерные ферменты сыворотки (AST, ALT и ALP).Параллельно с этими изменениями TSAV также предотвращал окислительный стресс, вызванный CCl 4 , путем ингибирования перекисного окисления липидов (MDA) и восстановления уровней антиоксидантных ферментов (SOD, CAT, GR и GPX), GSH и GSSG. Кроме того, TSAV снижал уровни сывороточного TNF-, α и IL-6 и ингибировал уровни iNOS и NO в сыворотке. Гистопатология печени показала, что TSAV уменьшал воспалительную инфильтрацию и очаговый некроз, вызванные CCl 4 . TSAV (200 мг / кг) также значительно снижал экспрессию белков Bak, Bax и мРНК Fas, FasL, p53 и NF- κ B p65 и увеличивал экспрессию мРНК Bcl-2 и белка.Между тем, TSAV значительно подавлял активность каспазы-3 и каспазы-8 и предотвращал апоптоз печеночных клеток, индуцированный CCl 4 . Кроме того, TSAV проявлял антиоксидантную активность за счет улавливания гидроксильных групп и свободных радикалов DPPH in vitro . Эти результаты показали, что TSAV может защищать мышей от острого повреждения печени, вызванного CCl 4 , возможно, за счет антиоксидантной, противовоспалительной активности и регуляции генов, связанных с апоптозом.

1. Введение

Печень играет важную роль в регулировании нескольких важных функций, включая синтез, секрецию и метаболизм ксенобиотиков [1].Повреждение печени является широко распространенной патологией, которая может влиять на эти физиохимические функции и быть вызвана вирусным гепатитом, алкоголизмом или токсичными для печени химическими веществами, одним из которых является четыреххлористый углерод (CCl 4 ). Он метаболизируется ферментной системой P450 с образованием активных продуктов метаболизма - трихлорметильных свободных радикалов, которые могут инициировать процесс перекисного окисления липидов и способствовать токсичности для печени [2]. Растительные продукты и традиционная китайская медицина широко используются для защиты от токсичности, вызванной химическими веществами, из-за их безопасности и эффективности.Ряд исследований показал, что экстракты трав обладают антиоксидантной активностью в отношении гепатотоксичности CCl 4 за счет снижения окислительного стресса и ингибирования перекисного окисления липидов [2, 3].

Actinidia valvata Данн, относящийся к роду Actinidia , представляет собой кустарник, который в основном растет в восточном Китае [4] и имеет ряд применений в традиционной китайской медицине и народных травах. Корень этого растения, широко известного в Китае как Мао жэньшэнь, проявлял заметную противовоспалительную и противоопухолевую активность и долгое время использовался для лечения гепатомы, карциномы легких и миеломы [5, 6].Общие сапонины A. valvata Dunn root (TSAV) считаются одной важной группой фармакологически активных ингредиентов против воспаления и опухоли [7, 8]. Недавние исследования показали, что некоторые тритерпеноиды, выделенные из TSAV, проявляют противоопухолевую активность in vitro [9, 10]. Однако до сих пор, насколько нам известно, сообщения о гепатопротекторной активности TSAV против повреждения печени, вызванного CCl 4 , не обнаружено.

Настоящее исследование направлено на оценку гепатопротекторного действия TSAV против CCl 4 -индуцированного повреждения печени.Были измерены активности печеночных ферментов у мышей, а также исследованы возможные механизмы гепатопротекции.

2. Материалы и методы
2.1. Растительный материал

Actinidia valvata Корни данн были собраны в округе Чаншань, провинция Чжэцзян, Китай, в сентябре 2006 г. и подтверждены профессором Чжэн Ханьчэном (Фармацевтический факультет Второго военно-медицинского университета, Шанхай, Китай). Образец ваучера (№ 20060929) депонирован на кафедре традиционной китайской медицины Второго военно-медицинского университета.

2.2. Химические вещества и реагенты

Макропористая смола D101 была приобретена на химическом заводе Haiguang (Тяньцзинь, Китай). CCl 4 и силимарин были приобретены у Sigma Chemical Co. (Сент-Луис, Миссури, США). Диагностические наборы для измерения ALT, AST, ALP, TNF-, α , IL-6, iNOS, NO, MDA, SOD, CAT, GR, GPX, GSH и GSSG были приобретены в Нанкинском институте биоинженерии Цзяньчэн (Нанкин, Цзянсу). Провинция, Китай). Набор для экстракции лестничной ДНК, набор для анализа активности каспазы-3 и caspaes-8, реагент Trizol, буфер для лизиса клеток для вестерн-блоттинга и IP были приобретены в Институте биотехнологии Beyotime (Наньтун, провинция Цзянсу, Китай).Реагент для двухэтапной ИГХ-детекции был приобретен у компании Zhongshan Goldenbridge Biotechnology Co. Ltd. (Пекин, Китай). Антитела против NF- κ B p65, Fas, FasL и GAPDH были поставлены Santa Cruz Biotechnology (Санта-Крус, Калифорния, США). Все остальные химические вещества и растворители были высококачественными коммерчески доступными сортами.

2.3. Получение TSAV из лекарственного растения

TSAV получали, как описано Zheng et al. [11], с небольшими изменениями. Лекарственное растение измельчали ​​в порошки (20-40 меш), а затем 600 г порошков кипятили с обратным холодильником с 3500 мл 80% -ного водного этанола в течение 2 часов.Затем процедуру экстракции повторяли еще раз дважды. Растворители упаривали досуха под вакуумом, а остаток разбавляли дистиллированной водой. После отделения осадка фильтрованием оставшиеся растворы дополнительно разделяли на макропористых смолах D101 и элюировали водой, 40% водным этанолом и 90% водным этанолом с получением трех фракций. Растворы, элюированные водой и 40% водным этанолом, отбрасывали, а 90% водные растворы этанола собирали и упаривали досуха при пониженном давлении при 50 ° C.Получали коричневые порошки (24,34 г), содержащие общие сапонины.

Содержание общих сапонинов определяли колориметрическим методом Vanillin-HClO 4 [12]. Количественное определение было выполнено с использованием калибровки внешнего стандарта, и 2 α , 3 α , 24-тригидроксиурс-12-ен-28-овая кислота была использована в качестве эталонного стандарта для расчета общего содержания сапонинов. Серии стандартов 2 α , 3 α , 24-тригидроксиур-12-ен-28-овой кислоты (в диапазоне от 5 μ г / мл до 30 μ г / мл) были приготовлены в 80 г. % водного раствора этанола, чтобы получить лайнер-кривую с коэффициентом корреляции 0.9997 (). Поглощение измеряли при 550 нм спектрофотометром UV-Vis (TU-1901, Persee, Пекин, Китай). Общее содержание сапонинов составляло 62,4% (мас. / Мас.).

2.4. Действия TSAV
по очистке свободных радикалов 2.4.1. Анализ улавливания радикалов DPPH

Активность улавливания свободных радикалов измеряли с точки зрения способности отдавать или улавливать радикалы с использованием стабильного радикала DPPH. Различные концентрации исследуемого образца и аскорбиновой кислоты были приготовлены в 80% водном этаноле, и 2 мл раствора образца были смешаны с 2 мл 0.Раствор DPPH в этаноле 1 мг / мл. Реакционную смесь интенсивно встряхивали и инкубировали при 37 ° C в течение 30 мин. Поглощение измеряли при 517 нм с использованием спектрофотометра УФ-видимого диапазона. Процент ингибирования радикала DPPH образцами был рассчитан с использованием следующего уравнения: Степень ингибирования (%) =, где - абсорбция контроля, - абсорбция образца и - абсорбция образца в тех же условиях, что и с этанолом вместо раствора DPPH. Аскорбиновая кислота использовалась в качестве контрольного соединения.Рассчитывали значение IC 50 (концентрация, необходимая для улавливания 50% свободных радикалов DPPH). Все определения были выполнены в трех экземплярах.

2.4.2. Анализ улавливания гидроксильных радикалов

Тест улавливания гидроксильных радикалов проводили описанным методом [13]. Реакционный раствор инкубировали при 37 ° C в течение 30 мин. Поглощение измеряли при 520 нм с использованием спектрофотометра УФ-видимого диапазона. Степень ингибирования рассчитывалась следующим образом:, где - абсорбция контроля, - абсорбция образца и - абсорбция холостого образца.

2,5. Животные и план эксперимента

Самцов мышей Kunming (18–22 г) были получены из лаборатории Sippr-Bk. Animal Ltd. Co. (Шанхай, Китай), и их кормили сертифицированной стандартной диетой и водопроводной водой ad libitum . Температуру и влажность регулировали на уровне 21–23 ° С и 50–60% соответственно. Протокол исследования соответствовал Руководству по уходу и использованию лабораторных животных, принятому Национальным институтом здравоохранения США, и был одобрен комитетами по этике животных Второго военно-медицинского университета.

После одной недели акклиматизации мышей случайным образом разделили на шесть групп по десять человек в каждой: (I) контрольная группа; (II) группа CCl 4 ; (III) группа низких доз TASV; (IV) группа средней дозы TSAV; (V) группа с высокой дозой TSAV; (VI) силимариновая группа. Группы I и II получали 0,5% CMC-Na (200 мг / кг), группы III, IV и V получали TSAV (50, 100 и 200 мг / кг соответственно), а группа VI получала силимарин (200 мг / кг). ). Лекарства и носитель вводили (например) один раз в день в течение 5 дней подряд.Через два часа после последней обработки мышей в группах II – VI обрабатывали 0,3% CCl 4 (10 мл / кг, внутрибрюшинно, разведение оливковым маслом), как описано ранее [14]. Через 24 часа после введения CCl 4 кровь собирали и мышей умерщвляли. Собранную кровь помещали на 45 минут для образования сгустка, а затем центрифугировали 4000 × g в течение 10 минут для отделения сыворотки, которую использовали для биохимических анализов. Печень немедленно промывали физиологическим раствором, промокали фильтровальной бумагой, взвешивали и, наконец, хранили при -80 ° C в ожидании биохимических анализов.Одна часть печени была вырезана и помещена в колбу, содержащую 10% забуференный раствор формалина для следующих гистопатологических анализов.

2.6. Биохимические параметры сыворотки

Активность ALT, AST, ALP, TNF-, α , IL-6, iNOS и NO в сыворотке измеряли спектрофотометром с использованием наборов ферментов в соответствии с инструкциями производителя.

2.7. Перекисное окисление липидов и активность антиоксидантных ферментов

Ткани печени гомогенизировали в замороженном физиологическом растворе и центрифугировали при 10000 × g в течение 10 минут.Супернатант использовали для измерения SOD, CAT, GR, GPX, GSH и GSSG, которые определяли, следуя инструкциям на коммерческих наборах. Перекисное окисление липидов оценивали с помощью диагностических наборов MDA.

2,8. Активность каспазы-3 и каспазы-8

Активность каспазы-3 и каспазы-8 измеряли строго в соответствии с инструкциями набора для анализа активности каспазы-3 и каспазы-8. Вкратце, смесь из 80 мкл л буфера для детектирования, 10 мкл л образцов и 10 мкл мкл Ac-IETD- p NA инкубировали при 37 ° C в течение 60 мин и измеряли OD 405 . .Их активности рассчитывали на основе стандартной кривой.

2.9. Гистология и иммуногистохимия

Образцы тканей, фиксированные формалином, заливали парафином и делали 5 срезов размером мкм и мкм. Повторные срезы окрашивали гемотоксилином и эозином (HE) для наблюдения за повреждением печени. Дополнительные срезы использовали для следующего иммуногистохимического теста с помощью двухэтапного ИГХ обнаружения. 3% H 2 O 2 использовали для блокирования активности эндогенной пероксидазы в течение 10 минут и нормальной козьей сыворотки для блокирования неспецифического связывания белка в течение 30 минут.После репарации антигена в микроволновой печи срезы инкубировали при 4 ° C в течение ночи с кроличьими анти-Bcl-2 и анти-p53 антителами (1: 100, разведение) с последующей инкубацией при 37 ° C в PV6001 в течение 30 минут и визуализировали. с субстратом 3,3'-диаминобензидинтетрагидрохлорид (DAB) и контрастным окрашиванием гемотоксилином. Изображение было получено с помощью световой микроскопии с инвертированным цифровым изображением (Nikon Eclipse TE2000-U, Nikon Instruments Co. Ltd., Токио, Япония). Окрашенные в коричневый цвет ткани считались положительными, и значение IOD анализировалось с помощью программного обеспечения Image-Pro Plus (Media Cybernetics, MD, USA) для оценки экспрессии белков [15, 16].

2.10. Экстракция белка и вестерн-блот-анализ

Печень дважды промывали холодным PBS, а затем лизировали в соответствующем объеме холодного буфера для лизиса, содержащего 1 мМ лизатов PMSF, которые центрифугировали при 12000 × g в течение 15 минут при 4 ° C. Был получен общий белок и содержание белка определено с помощью кумасси бриллиантового синего G. Анализы вестерн-блоттинга выполнялись следующим образом: белок (5 мг / мл) денатурировали путем смешивания с равным объемом 2-кратного буфера для загрузки образца и затем кипячения при 100 ° С. ° C в течение 5 мин [17].Равное количество белка наносили на гель SDS, разделяли электрофорезом и переносили на PVDF-мембрану. Для всего электрофореза использовали 10% полиакриламидный гель. Трансмембранное время для NF- κ B p65, Fas, FasL и GAPDH составляло 50, 45, 35 и 30 минут соответственно. После инкубации PVDF-мембраны с 10 мМ TBS с 1,0% Tween 20 и 5% обезвоженного обезжиренного молока для блокирования неспецифического связывания белков мембрану инкубировали с первичными антителами в течение ночи при 4 ° C и инкубировали либо кроличьи анти-NF- κ . B p65 (разведение 1: 600), кроличьи анти-Fas (разведение 1: 200), кроличьи анти-FasL (разведение 1: 500) или мышиные анти-GAPDH (разведение 1: 2000).Затем блоты инкубировали с козьим антимышиным IgG, конъюгированным с пероксидазой хрена, или с козьим антимышиным IgG, конъюгированным с пероксидазой хрена, в течение 2 ч при комнатной температуре в разведении 1: 2000. Обнаружение проводили методом усиленной хемилюминесценции и фотографировали с помощью системы визуализации геля BioSpectrum (UVP, Upland, CA, USA). Данные были нормализованы с помощью GAPDH (IOD целевого белка по сравнению с IOD белка GAPDH).

2.11. Обратная транскрипционная полимеразная цепная реакция (ОТ-ПЦР)

Реагент тризол использовали для получения РНК клеток.Каждый раз в следующей ОТ-ПЦР требовалось 500 нг общей РНК. Конкретно разработанные праймеры показаны в таблице 1. ОТ-ПЦР выполняли согласно протоколу набора Takara RNA PCR Kit и амплифицировали в системе TC-512 PCR (Techne, Barloworld Scientific Ltd., UK). Образцы РНК сначала подвергали обратной транскрипции и немедленно амплифицировали с помощью ПЦР. Профиль амплификации был выполнен денатурацией при 94 ° C в течение 1 мин, отжигом при 60 ° C и удлинением при 72 ° C в течение 1 мин, а для амплификации использовалось 50 дополнительных циклов.Величины IOD полос электрофореза анализировали с помощью системы визуализации геля BioSpectrum.

TGTAGCAGTAC8

Название гена Праймеры (5′ – 3 ′)

Bcl-2

Вах F: GGCAGCCCCGGCGCGGACCCCTCGGTCA
Р: TAACATCAGTTCCTCTCAGAGGAACCT

Бак F: ACAAGGACCAGGTCCTCCTAGGC
Р: GCGATGCAATGGTGCAGTATGAT

GAPDH F: ATGGTGAAGGTCGGTGTGAAC
R: GTCTTCTGGGTGGCAGTGATG

; R: обратный праймер.
2,12. TUNEL Assay

Апоптоз определяли окрашиванием TUNEL с использованием набора для определения апоптоза in situ (Roche, Шанхай, Китай). Залитые в парафин ткани печени обрабатывали для маркировки TUNEL. Изображения были получены с помощью флуоресцентной микроскопии (Olympus, Токио, Япония).

2.13. DNA Ladder

Образцы ДНК экстрагировали с использованием набора для экстракции ДНК Ladder со спин-колонкой, затем разделяли электрофоретически в 1% агарозном геле и окрашивали бромидом этидия.Гель агарозы визуализировали и фотографировали в ультрафиолетовом свете с помощью системы визуализации геля BioSpectrum.

2.14. Статистический анализ

Все данные были выражены в виде среднего значения ± стандартное отклонение (SD), а значимое различие между группами было статистически проанализировано с помощью однофакторного дисперсионного анализа. Разница считалась значимой при.

3. Результаты
3.1. Антиоксидантная активность TSAV In vitro

Было протестировано действие TSAV по улавливанию свободных радикалов, результаты представлены на рисунке 1.TSAV в диапазоне 15–250 мкг / мкг / мл проявлял зависящую от концентрации активность поглощения DPPH (ингибирование 18,23–88,06%, IC 50 87,78 мк мкг / мл), будучи менее активным, чем аскорбиновая кислота (IC 50 12,08 μ г / мл). Эффект улавливания гидроксильных радикалов составлял 36,75%, 46,29% и 56,87% соответственно для 50, 75 и 100 μ г / мл TSAV. Значение IC 50 составляло 74,21 μ г / мл, и его сравнивали с аскорбиновой кислотой (IC 50 20.86 μ г / мл) в тех же условиях. Настоящее исследование показало, что TSAV может эффективно улавливать DPPH и гидроксильные радикалы.

3.2. Гистопатология

Гистопатологический профиль контрольных мышей показал нормальные гепатоциты с хорошей цитоплазмой, выступающим ядром, ядрышком и центральной веной. У этих мышей не было признаков воспаления или некроза (рис. 2 (а)). У мышей, получавших только CCl 4 , срезы печени показали ядерный пикноз гепатоцитов, дегенерацию печеночного канатика, воспалительную инфильтрацию и выраженный некроз (рис. 2 (b)).Предварительная обработка TSAV в дозах 50 и 100 мг / кг показала уменьшение площади некроза и воспалительных инфильтратов (рисунки 2 (c) и 2 (d)). TSAV и силимарин в дозе 200 мг / кг показали разреженную инфильтрацию воспалительных клеток и большее уменьшение ядерного пикноза печеночных клеток (рисунки 2 (e) и 2 (f)) по сравнению с дозами 50 и 100 мг / кг. Эти результаты показали, что TSAV может уменьшить тяжесть поражения печени и эффективно защитить печень от повреждения, вызванного CCl 4 .

3.3. Сывороточные ферменты

Эффекты TSAV при трех уровнях доз на сывороточные маркерные ферменты при поражении печени, вызванном CCl 4 , показаны в таблице 2. Сывороточные активности ферментов AST, ALT и ALP в группе CCl 4 были значительно увеличился по сравнению с контрольной группой, что отражало тяжесть поражения печени. TSAV с различными дозами и предварительная обработка силимарином значительно снижали уровни сывороточных AST, ALT и ALP по сравнению с группой CCl 4 .Было обнаружено, что эффекты TSAV в высоких дозах более заметно снижают их активность, чем силимарин.

.

Смотрите также